ID: 1156160296_1156160307 |
View in Genome Browser |
Spacer: 1 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1156160296 | 1156160307 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 18:34350945-34350967 | 18:34350969-34350991 |
| Sequence | CCTGCTGCCTCTGCCCCTCCTGA | TTTGGGCTCCCCTCTGGAAGGGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 3, 2: 12, 3: 104, 4: 982} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||