ID: 1156232354_1156232362

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1156232354 1156232362
Species Human (GRCh38) Human (GRCh38)
Location 18:35165906-35165928 18:35165939-35165961
Sequence CCCCTTCCACCTCTGATCTCCTA AACAAGGTGCAAGCCAATAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!