ID: 1156242120_1156242133

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1156242120 1156242133
Species Human (GRCh38) Human (GRCh38)
Location 18:35264857-35264879 18:35264910-35264932
Sequence CCCATTTTTGCCAGGCACGGTGG GCCGAGGCGGGAGGATCACGAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 39, 3: 306, 4: 1387} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!