ID: 1156502398_1156502413

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1156502398 1156502413
Species Human (GRCh38) Human (GRCh38)
Location 18:37567750-37567772 18:37567802-37567824
Sequence CCCCAGCTGCCTGCAAACCCAGG GAGCTCTCCAGCGCCGGAGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!