ID: 1156516856_1156516859

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1156516856 1156516859
Species Human (GRCh38) Human (GRCh38)
Location 18:37687473-37687495 18:37687501-37687523
Sequence CCTTGTGCAGTACTGGGGCAGGA TGATATTTGTGATGTGAATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 193} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!