ID: 1156519318_1156519323

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1156519318 1156519323
Species Human (GRCh38) Human (GRCh38)
Location 18:37708294-37708316 18:37708310-37708332
Sequence CCTGCTTCCTTTTGGCCTCACAC CTCACACACTGAGCAGGGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 26, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!