ID: 1157258151_1157258158

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1157258151 1157258158
Species Human (GRCh38) Human (GRCh38)
Location 18:46156630-46156652 18:46156678-46156700
Sequence CCTTCCTGCCACAGACTAAATGT CAGTGAGGATGGAGAACAGAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!