ID: 1157944531_1157944536

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1157944531 1157944536
Species Human (GRCh38) Human (GRCh38)
Location 18:51964236-51964258 18:51964275-51964297
Sequence CCATGACTCATATTCTTCATACC TCACTACTGCCTTTGCACTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 185} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!