ID: 1158115114_1158115130

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1158115114 1158115130
Species Human (GRCh38) Human (GRCh38)
Location 18:53986902-53986924 18:53986952-53986974
Sequence CCCACACCTCCTCCCAGAAGAAA TGGATGGTCTCTACATGGCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!