ID: 1158354376_1158354381

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1158354376 1158354381
Species Human (GRCh38) Human (GRCh38)
Location 18:56600365-56600387 18:56600378-56600400
Sequence CCTCCAACAGAATATTGAGACTG ATTGAGACTGGGGAACAAAGTGG
Strand - +
Off-target summary {0: 5, 1: 2, 2: 0, 3: 14, 4: 133} {0: 1, 1: 6, 2: 2, 3: 21, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!