ID: 1158622146_1158622149

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1158622146 1158622149
Species Human (GRCh38) Human (GRCh38)
Location 18:59042209-59042231 18:59042229-59042251
Sequence CCTGCCAGTCTTTCTCGTTGCCC CCCTCTCTTGATGAACTTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 153} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!