ID: 1158739198_1158739208

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1158739198 1158739208
Species Human (GRCh38) Human (GRCh38)
Location 18:60120364-60120386 18:60120415-60120437
Sequence CCATCCCCCATCTCCCTCTAATG CCACTTGATGAATAACCACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 67, 4: 678} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!