ID: 1158859204_1158859210

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1158859204 1158859210
Species Human (GRCh38) Human (GRCh38)
Location 18:61575638-61575660 18:61575685-61575707
Sequence CCAAGAATTTCCAGCAACCACCA GACTCTTTCTCTAAACCTCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 13, 3: 34, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!