ID: 1159190425_1159190430

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1159190425 1159190430
Species Human (GRCh38) Human (GRCh38)
Location 18:65034783-65034805 18:65034835-65034857
Sequence CCCTTTTAGAGTGGCAGTGATCT AGCAGAACTAAAAAACCTTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 20, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!