ID: 1159393087_1159393090

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1159393087 1159393090
Species Human (GRCh38) Human (GRCh38)
Location 18:67820417-67820439 18:67820468-67820490
Sequence CCTTTCAAATCAGCTAGTGGGGG AGACCCAGTTGCTGCTCCTTCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 20, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!