ID: 1159634667_1159634676

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1159634667 1159634676
Species Human (GRCh38) Human (GRCh38)
Location 18:70790098-70790120 18:70790132-70790154
Sequence CCAGCTCCCTCTCATGACATGTG AATTCGAGGTGAGATTTGGGTGG
Strand - +
Off-target summary {0: 2, 1: 32, 2: 327, 3: 1074, 4: 3043} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!