ID: 1159673032_1159673038

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1159673032 1159673038
Species Human (GRCh38) Human (GRCh38)
Location 18:71246773-71246795 18:71246788-71246810
Sequence CCTGTAATCCCAGCACTTTGGAA CTTTGGAAGGCCAAGGTGGATGG
Strand - +
Off-target summary No data {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!