ID: 1159676582_1159676587

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1159676582 1159676587
Species Human (GRCh38) Human (GRCh38)
Location 18:71291161-71291183 18:71291186-71291208
Sequence CCCATACACTGTTTAAAGCAACA CTAGGCCACTCTCAAAGGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 26, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!