ID: 1160090144_1160090152

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1160090144 1160090152
Species Human (GRCh38) Human (GRCh38)
Location 18:75819180-75819202 18:75819233-75819255
Sequence CCAGTGCACCTCTCTCCCTGATG TTTCATGGCCCTTGAATTTTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!