ID: 1160380798_1160380804

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1160380798 1160380804
Species Human (GRCh38) Human (GRCh38)
Location 18:78453861-78453883 18:78453874-78453896
Sequence CCACACGCCACCTTCCCAGGCAG TCCCAGGCAGCCCCCAGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 364} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!