ID: 1160499132_1160499137

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1160499132 1160499137
Species Human (GRCh38) Human (GRCh38)
Location 18:79393928-79393950 18:79393943-79393965
Sequence CCCGGCAACGGCATTAAACAGAG AAACAGAGGGAAACAGACCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 56, 4: 435}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!