ID: 1160571005_1160571009

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1160571005 1160571009
Species Human (GRCh38) Human (GRCh38)
Location 18:79817847-79817869 18:79817863-79817885
Sequence CCCTCTCTCATTCCTGGTTTGAG GTTTGAGCCCGTGGAAGCCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!