ID: 1160668430_1160668447

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1160668430 1160668447
Species Human (GRCh38) Human (GRCh38)
Location 19:344502-344524 19:344545-344567
Sequence CCCCGGCCCCCGCCCGCCCCGCG AGCCCGCGATGTGGCAGCCGGGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 60, 3: 333, 4: 2220} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!