ID: 1160668432_1160668454

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1160668432 1160668454
Species Human (GRCh38) Human (GRCh38)
Location 19:344504-344526 19:344555-344577
Sequence CCGGCCCCCGCCCGCCCCGCGCC GTGGCAGCCGGGGGAGTTGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 41, 4: 415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!