ID: 1160668436_1160668455

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1160668436 1160668455
Species Human (GRCh38) Human (GRCh38)
Location 19:344511-344533 19:344556-344578
Sequence CCGCCCGCCCCGCGCCGCCGCGC TGGCAGCCGGGGGAGTTGGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 42, 4: 507}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!