ID: 1160668437_1160668453

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1160668437 1160668453
Species Human (GRCh38) Human (GRCh38)
Location 19:344514-344536 19:344554-344576
Sequence CCCGCCCCGCGCCGCCGCGCATG TGTGGCAGCCGGGGGAGTTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 28, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!