ID: 1160668443_1160668465

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1160668443 1160668465
Species Human (GRCh38) Human (GRCh38)
Location 19:344528-344550 19:344573-344595
Sequence CCGCGCATGCGCACTGCAGCCCG GGGGGGTGGGGGCCGGCCGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 17, 3: 262, 4: 2734}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!