ID: 1160700013_1160700025

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1160700013 1160700025
Species Human (GRCh38) Human (GRCh38)
Location 19:501708-501730 19:501742-501764
Sequence CCTCCCCGGAGTCTCCCGACACC GTCTCCCGACACCACCTCCCAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 12, 4: 121} {0: 2, 1: 2, 2: 3, 3: 16, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!