ID: 1160782768_1160782778

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1160782768 1160782778
Species Human (GRCh38) Human (GRCh38)
Location 19:885157-885179 19:885189-885211
Sequence CCCAGGCCTGTCCCCAGAGCCCA CACAGGAACGCAAATGTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 131, 4: 728} {0: 1, 1: 0, 2: 0, 3: 9, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!