ID: 1160908069_1160908080

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1160908069 1160908080
Species Human (GRCh38) Human (GRCh38)
Location 19:1461020-1461042 19:1461050-1461072
Sequence CCCCTCACCCCACCCAGGTGGTG TCCTTCGGAACTTGTCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 393} {0: 1, 1: 0, 2: 0, 3: 7, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!