ID: 1160995355_1160995377

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1160995355 1160995377
Species Human (GRCh38) Human (GRCh38)
Location 19:1879811-1879833 19:1879860-1879882
Sequence CCCTCCTGCAGGGCCGCCCACCT CCCCCCGCCTGGTCCCCTCTTGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 1, 3: 34, 4: 283} {0: 2, 1: 6, 2: 2, 3: 16, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!