ID: 1160995360_1160995379

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1160995360 1160995379
Species Human (GRCh38) Human (GRCh38)
Location 19:1879824-1879846 19:1879861-1879883
Sequence CCGCCCACCTTCCTCCCAGGGAA CCCCCGCCTGGTCCCCTCTTGGG
Strand - +
Off-target summary {0: 9, 1: 4, 2: 9, 3: 79, 4: 672} {0: 2, 1: 2, 2: 7, 3: 13, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!