|
Left Crispr |
Right Crispr |
Crispr ID |
1160995363 |
1160995370 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
19:1879831-1879853
|
19:1879849-1879871
|
Sequence |
CCTTCCTCCCAGGGAAGCCCGCC |
CCGCCCCCCGGCCCCCCGCCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 9, 1: 0, 2: 2, 3: 20, 4: 301} |
{0: 2, 1: 4, 2: 12, 3: 155, 4: 1214} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|