ID: 1160995363_1160995379

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1160995363 1160995379
Species Human (GRCh38) Human (GRCh38)
Location 19:1879831-1879853 19:1879861-1879883
Sequence CCTTCCTCCCAGGGAAGCCCGCC CCCCCGCCTGGTCCCCTCTTGGG
Strand - +
Off-target summary {0: 9, 1: 0, 2: 2, 3: 20, 4: 301} {0: 2, 1: 2, 2: 7, 3: 13, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!