ID: 1160995372_1160995384

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1160995372 1160995384
Species Human (GRCh38) Human (GRCh38)
Location 19:1879853-1879875 19:1879871-1879893
Sequence CCCCCGGCCCCCCGCCTGGTCCC GTCCCCTCTTGGGTGTGCCCAGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 13, 3: 64, 4: 736} {0: 6, 1: 4, 2: 2, 3: 13, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!