|
Left Crispr |
Right Crispr |
Crispr ID |
1160995375 |
1160995384 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
19:1879856-1879878
|
19:1879871-1879893
|
Sequence |
CCGGCCCCCCGCCTGGTCCCCTC |
GTCCCCTCTTGGGTGTGCCCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 4, 2: 9, 3: 90, 4: 864} |
{0: 6, 1: 4, 2: 2, 3: 13, 4: 151} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|