ID: 1160995382_1160995390

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1160995382 1160995390
Species Human (GRCh38) Human (GRCh38)
Location 19:1879864-1879886 19:1879888-1879910
Sequence CCGCCTGGTCCCCTCTTGGGTGT CCCAGGCTGAGCTGCCCCCAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 17, 4: 204} {0: 6, 1: 1, 2: 9, 3: 60, 4: 426}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!