|
Left Crispr |
Right Crispr |
| Crispr ID |
1160995392 |
1160995407 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
19:1879902-1879924
|
19:1879943-1879965
|
| Sequence |
CCCCCAGGGTCGCCCTCACCTGG |
CGGCGTCGATGTCGGCATAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 2, 2: 4, 3: 19, 4: 240} |
{0: 5, 1: 3, 2: 4, 3: 1, 4: 8} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|