ID: 1160995399_1160995409

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1160995399 1160995409
Species Human (GRCh38) Human (GRCh38)
Location 19:1879914-1879936 19:1879957-1879979
Sequence CCCTCACCTGGTGCGCAGGGCCT GCATAGAGGTTCCTCTCGGAAGG
Strand - +
Off-target summary {0: 11, 1: 0, 2: 1, 3: 14, 4: 167} {0: 5, 1: 1, 2: 6, 3: 4, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!