ID: 1161155178_1161155184

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1161155178 1161155184
Species Human (GRCh38) Human (GRCh38)
Location 19:2728822-2728844 19:2728856-2728878
Sequence CCACTCCATGCCAGGAGCTCCCC ACCACAGATGTCCCCAGACATGG
Strand - +
Off-target summary No data {0: 5, 1: 4, 2: 5, 3: 54, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!