ID: 1161267344_1161267351

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1161267344 1161267351
Species Human (GRCh38) Human (GRCh38)
Location 19:3370349-3370371 19:3370387-3370409
Sequence CCCTCTGGGTCTCTCTGTGCATC CCCTCCCCTCTCTGCGGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 52, 4: 412} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!