ID: 1161323154_1161323169

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1161323154 1161323169
Species Human (GRCh38) Human (GRCh38)
Location 19:3650456-3650478 19:3650504-3650526
Sequence CCATGTCTGGGGACATCTGTGGT CCCGGAGTGGGTGGAGGCCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 100, 4: 517}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!