ID: 1161518795_1161518801

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1161518795 1161518801
Species Human (GRCh38) Human (GRCh38)
Location 19:4712078-4712100 19:4712097-4712119
Sequence CCCCAACGGGAGCAAGTGGCCCA CCCAAGACTGTGGGCGCCACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 14, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!