ID: 1161559134_1161559136

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1161559134 1161559136
Species Human (GRCh38) Human (GRCh38)
Location 19:4961394-4961416 19:4961427-4961449
Sequence CCAGACTGCTTAGCGTCTGAGAT AGTCCTCTGCCCACGAGAGCAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 9, 4: 164} {0: 2, 1: 0, 2: 1, 3: 5, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!