ID: 1161649324_1161649338

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1161649324 1161649338
Species Human (GRCh38) Human (GRCh38)
Location 19:5474700-5474722 19:5474753-5474775
Sequence CCCTATGGCAGAACCTCGCCTGG TGGCTGGAGCAGAGTGAGGAAGG
Strand - +
Off-target summary No data {0: 10, 1: 32, 2: 118, 3: 371, 4: 1327}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!