ID: 1161649330_1161649338

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1161649330 1161649338
Species Human (GRCh38) Human (GRCh38)
Location 19:5474718-5474740 19:5474753-5474775
Sequence CCTGGCATGTTGGAGGAACAGCG TGGCTGGAGCAGAGTGAGGAAGG
Strand - +
Off-target summary {0: 3, 1: 10, 2: 25, 3: 72, 4: 277} {0: 10, 1: 32, 2: 118, 3: 371, 4: 1327}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!