ID: 1161943275_1161943278

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1161943275 1161943278
Species Human (GRCh38) Human (GRCh38)
Location 19:7419096-7419118 19:7419114-7419136
Sequence CCCACACTTGGCCTCTGTACCCC ACCCCAGATGTACCCACACTCGG
Strand - +
Off-target summary No data {0: 4, 1: 0, 2: 4, 3: 16, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!