ID: 1162001130_1162001136

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1162001130 1162001136
Species Human (GRCh38) Human (GRCh38)
Location 19:7745833-7745855 19:7745872-7745894
Sequence CCTGCAGCTTAGATTTCTCTGGA CCTTCAGCCGGGTCAGCTCCTGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 9, 3: 21, 4: 204} {0: 6, 1: 6, 2: 1, 3: 18, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!