ID: 1162131684_1162131688

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1162131684 1162131688
Species Human (GRCh38) Human (GRCh38)
Location 19:8529982-8530004 19:8530000-8530022
Sequence CCAGGTGAGGGTATACCTGTGAT GTGATGGAACAGATGGATCTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 1, 4: 58} {0: 3, 1: 1, 2: 0, 3: 16, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!