ID: 1162412936_1162412942

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1162412936 1162412942
Species Human (GRCh38) Human (GRCh38)
Location 19:10517421-10517443 19:10517445-10517467
Sequence CCGCAGTCGCGCTGCCTTGAACC AGTGAGCGGACGCCGCTCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 54} {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!